We invite you to be our distributor in your region. Contact: tel. +7 (960) 790-67-04, e-mail: sales@biosan-nsk.ru
Biosan is certified as meeting the requirements ISO 9001:2015 and ISO 13485:2016
Biosan LLC is an R&D executor with the support of the Foundation for Assistance to Small Innovative Enterprises.Т7 RNA Polymerase
Features: Isolated from a recombinant source.
T7 polymerase is extremely promoter-specific and transcribes only DNA downstream of a T7 promoter.
Incorporates modified nucleotides (e.g., aminoallyl-, biotin-, fluorescein-, digoxigenin-labeled nucleotides)
T7 polymerase is extremely promoter-specific and transcribes only DNA downstream of a T7 promoter.
Incorporates modified nucleotides (e.g., aminoallyl-, biotin-, fluorescein-, digoxigenin-labeled nucleotides)
T7 RNA polymerase is a DNA-dependent RNA polymerase with strict specificity for its respective double-stranded promoters. It catalyzes the 5'→3' synthesis of RNA on either single-stranded DNA or double-stranded DNA downstream from it promoter.
Highlights
• Incorporates modified nucleotides (e.g., aminoallyl-, biotin-, fluorescein-, digoxigenin-labeled nucleotides)
Applications
Synthesis of unlabeled and labeled RNA that can be used:
• For hybridization, in vitro RNA translation
• As aRNA, siRNA, substrate in RNase protection assays, template for genomic DNA sequencing
• In studies of RNA secondary structure and RNA-protein interactions, RNA splicing
Consensus promoter sequence:
T7: TAATACGACTCACTATAGGGAGA
Highlights
• Incorporates modified nucleotides (e.g., aminoallyl-, biotin-, fluorescein-, digoxigenin-labeled nucleotides)
Applications
Synthesis of unlabeled and labeled RNA that can be used:
• For hybridization, in vitro RNA translation
• As aRNA, siRNA, substrate in RNase protection assays, template for genomic DNA sequencing
• In studies of RNA secondary structure and RNA-protein interactions, RNA splicing
Consensus promoter sequence:
T7: TAATACGACTCACTATAGGGAGA
